The diagrammatic representation of a process in bacteria is given below: Explain the three major steps in this process.

The process shown in the given diagram is transcription. During this process, the mRNA is synthesised from the template strand of DNA. The different steps involved in this process are: `1. Initiation. The DNA molecule unwinds and separates to form a small open complex. 2. Elongation. RNA polymerase moves along the template strand, synthesising an mRNA molecule. 3. Termination- occurs when a transcribing RNA polymerase releases the DNA template and the nascent RNA.

The diagrammatic representation of a process in bacteria is given below: Name the enzyme involved in this process.

The process shown in the given diagram is transcription. During this process, the mRNA is synthesised from the template strand of DNA. The enzyme RNA polymerase is the main enzyme involved in this process.

In molecular biology cistron is generally used as a synonym of the gene because

EASY

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

The messenger RNA transcribed from the structural genes in lac operon model is

EASY

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

The equivalent of a structural gene is:

MEDIUM

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

Which one of the following is wrongly matched?

HARD

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

Question Image

Write a possible RNA strand that can be transcribed from the above DNA molecule formed.

EASY

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

In the given transcription unit, identify the regions $I$ and $II$ respectively. Coding strand

Question Image

EASY

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

Which of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows

5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG '3

EASY

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

The coding strand of DNA is 5' ATCGAT 3'. The mRNA transcribed from this DNA would have the sequence _____.

HARD

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

What would happen if both the strands of the DNA act as templates for transcription?

EASY

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

Match the animals of Column $I$ with Column $II$ and select the correct options among the following:

	Column- $I$		Column- $II$
$1 .$	$DNA$ replication	$I$	$RNA$ polymerase
$2 .$	Translation	$II$	$DNA$ polymerase
$3 .$	Translation	$III$	Reverse transcriptase
$4 .$	Transcription	$IV$	Aminoacyl synthetase

Select the code for the correct answer from the options given below.

MEDIUM

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

If the sequence of nucleotides in a temperate strand of DNA is

3' ATGCTTCCGAAT 5'

, write the sequence in the corresponding region of the transcribed

m - RNA

.

HARD

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

Define transcription. Explain the process of transcription in bacteria with suitable diagram.

MEDIUM

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

Select the correct option:

MEDIUM

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

Explain the central dogma concept with a chart.

EASY

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

Elongation of the RNA polynucleotide chain always takes place:

HARD

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

A DNA sequence is provided below.

5' – ATGCATGCATGCATGCATGCATGCAT – 3'

Write down the sequence of its complementary strand.

MEDIUM

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

The diagrammatic representation of a process in bacteria is given below:

Question Image

Explain the three major steps in this process.

MEDIUM

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

The diagrammatic representation of a process in bacteria is given below:

Question Image

Name the enzyme involved in this process.

MEDIUM

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

Choose the wrong statements
A) Expressed sequences of eukaryotic genes are exons
B) Intervening gene sequences of eukaryotes that do not appear in processed RNA are cistrons
C) Process of removal of introns and joining of exons in defined order is splicing
D) Monocistronic transcriptional unit has only exons

HARD

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

Which one of the following is wrongly matched?

HARD

Life Sciences>From Molecules to Organisms: Structures and Processes>Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.>Structure and Function - Systems of specialized cells within organisms help them perform the essential functions of life.All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.

AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA?

In molecular biology, cistron is generally used as a synonym of the gene because

Important Questions on Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.

Learn and Prepare for any exam you want !