When ribosome encounters a stop codon in the mRNA, during translation, which one of the following binds to the stop codon? 

In the following passage there are blanks, each of which has been numbered. There are questions given below the passage and for each question, four words are suggested, one of which fits the blank appropriately. Find out the appropriate word in each case.

Whenever I go into a bank, I feel scared. Everybody and everything that I see there (1) ____ me. As for the manager the sight (2) ____ him simply terrifies me and (3) ____ me want to runaway (4) _____ I can. As soon as I (5) ____ the door of the bank I lose my head (6) ____ when I try to do any (7) ____ there, I behave like an idiot. I cannot explain (8) ____ for this but that is how it (9) ____ has been that is how it is (10) ____.

Select the most appropriate option for blank No. 10.

The sequence of a double stranded DNA, which produces a pentapeptide is given below:

$5\text{'}-\mathrm{TACATGATCATTTCACGGAATTTCTAGCATGTA}-3\text{'}$

$3\text{'}-\mathrm{ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT}-5 \text{'}$

The correct mRNA sequence corresponding to the pentapeptide is

How many peptide bonds will be formed in the polypeptide chain in the given diagram of protein synthesis?